greenbergariel12
greenbergariel12 greenbergariel12
  • 03-06-2022
  • Spanish
contestada

Please click on image to see questions. Greatly appreciated.

Please click on image to see questions Greatly appreciated class=

Respuesta :

yuly3000
yuly3000 yuly3000
  • 03-06-2022
23 is a - no estoy bien
24 is a- el dice que debo tomar medicina
25 is c- mi pie está roto
Answer Link
5bhk6thshh 5bhk6thshh
  • 03-06-2022
23- A (No estoy bien.)
24-A (El dice que debo tomar medicina)
25-C (Mi pie esta roto)
Answer Link

Otras preguntas

Which of the following is NOT a form of formal debate? A. an argument B. policy debate C. parliamentary debate D. Lincoln-Douglass debate
What is the diameter of a circle whose circumference measures 86 26/35? Use pi= 22/7
How well did feudalism establish order in the Middle ages?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
4x-2y=14 y=1/2x-1 Solve the system of linear equations by substitution. Check your answer.
an explanation describe if an orange pet mates with another orange pet, can they have any green offspring.
A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want
Please answer theses division problems!! 9 divided by 3/7
according to the United States constitution the president has the power to (A) negotiate treaties (B) amend the constitution (C) impeach members of congress
What is the adjective in the following sentence? The yellow sun hung brightly in the sky. a. Brightly b. Sun c. Yellow d. Hung